Polymorphism Study of TCF7L2 gene and related to some biochemical parameters in DM2 females Iraqi patients

 

Najwa Sh Ahmed1, Yasmin Ali Hadi1, Iqbal Hanash Dhefer2*

1Biotechnology Research, Molecular, and Biotechnology Laboratory, AL-Nahrain University, Baghdad, Iraq

2Nursing Department, AL-Suwaira Technical Institute, Middle Technical University

*Corresponding Author E-mail:  iqbal_defer@yahoo.com, iqbal.hanash@instituteofsuwaria.com

 

Abstract:

Transcription factor7 like 2 gene (TCF7L2) genomic polymorphisms are scanned to be powerfully related to diabetes mellitus type 2 (DM2) in female Iraqi population. The goal of this paper was to analyze the correlation of TCF7L2 gene polymorphisms with DM2 in a very female public of AL- Iraq. Techniques: 70 DM2 female patients and 60 healthy samples were chosen for the current study. Has been conducted designedly of one primer for amplification to scan the gene and using PCR technique with sequencing. We tend to measure the concentration of blood urea nitrogen, triglyceride total cholesterol, low density lipoprotein, high density lipoprotein, fasting glucose and creatinine in serum by utilizing equipment for chemical examination. Results: For total participants, the (G/A vs. AG + GT) were significantly greater in samples with DM2 than in healthy controls, and following some factors, like serum concentration of TC, TG, LDL, and HDL for DM2, the difference in significant was found. This result revealed that the risk of DM2 was raised with the existence of the GA and GT genotype of TCF7L2 gene in Iraqi female. The G allele frequency of TCF7L2 gene was greater in DM2 patients than in healthy control samples. Conclusions: Our analysis proposed that the TCF7L2 gene genetic polymorphisms were related with DM2 in the female populace of Iraq.

 

KEY WORDS: DM2, polymorphism, TCF7L2, triglyceride, total cholesterol.

 

 


INTRODUCTION:

Type 2 diabetes may be advance metabolic syndrome characterised by acute hyperglycemia ensuing by both environmental and genetic causes1,2. This advance metabolic disease products from communications between daily life and genes that are involved in the function or development of the insulin secreting in pancreas3,4. The transcription factor 7-like 2 allele, a Wnt signaling transcription component gene, has systematically been joined to DM2 through several societies5,6.

 

Many papers results that have checked out the consequences of the TCF7L2 Advisor to a variable that contains the effect depends on the context to get insulin. For instance, resistance of insulin, hyperglycemia and obesity seem to boost the consequences of the TCF7L2 variant7,8,9,10,11. While interpretations under the context-based influence of TCF7L2variant are often unknown, many mechanisms are programmed in a way that can contribute to type 2 diabetes. TCF7L2 variants are related to impaired incretin-stimulated insulin excretion12,13,14 and with enhanced production of hepatic glucose15,16. Additional mechanism may well be that TCF7L2 controls processing and synthesis of insulin in β cells, as submitted by the human pancreatic islets cells expression profiles17. In homozygotes of human for the TCF7L2, pancreatic islet size is enlarged, β cell volume is comparatively tiny, and glucose-stimulated insulin secretion in vitro is decreased18. These human knowledge counsel a mix of morphological and functional β cell variations supported the T allelomorph. Silencing of TCF7L2 in eutherian mammal islets or organism β cell lines conjointly leads to reduced preproinsulin gene expression, reduced glucose-stimulated insulin secretion, defective exocytosis of the insulin containing granules and reduced incretin-stimulated insulin secretion19. Clearly, variety of various mechanisms associated with regulation insulin processing and synthesis in β cells underlie this sort of genetically stimulated β cell dysfunction. Varied studies revealed a link between the TCF7L2 T allele and insulin secretion, however it's unknown if changed de novo insulin synthesis contributes to the present relationship in vivo and, consequently, if insulin synthesis may be a target for preventive methods for DM2.

 

The researcher then genotyped the 5 single nucleotide polymorphisms (rs7903146, rs12255372,, rs11196205, rs7895340 and rs7901695) among a well- described linkage  disequilibrium (LD) block of 92.1 kb spanning intron three and intron four of TCF7L2 and presented correlation between all 5 SNPs and DM2 in all 3cohorts. Additional studies in another European7,20,21,22, Mexican Americans23, African Americans23, and Asian populations recognized the sturdy correlation with an calculable populace due to risk of (17–28%)24,25,26,27,28. The TCF7L2 gene result may be a high quality cluster box-containing transcription factor that plays a vital role within the Wnt signaling pathway. This pathway may be a key element to the organizing of cell differentiation and proliferation29,30. However, the correlation study of the genetic polymorphism of TCF7L2 with DM2 during a female populace of Iraq has been absent.

 

In the gift study, we tend to analyze the association of TCF7L2 gene polymorphisms with DM2 in female Iraqi patients

 

MATERIAL AND METHODS:

Samples:

A complete of 130 females (age 25-45 years) were registered in this study, seventy patients with DM2 who have attended Specialist Center for endocrinology and diabetes, Baghdad, from January 2017 to June 2018 and 60 healthy individuals with matches as a control group. Physicians diagnosed all patients, and therefore the study was approved by the Center Ethical Committee. For each DM2 patient. Samples controls with a fasting plasma glucose (FPG) were registered from the center of health examination at the similar hospital, these samples had no case history of DM2. Body mass index (BMI) was evaluated as weight (kg) divided by height square (m2)31. Samples with impaired malignancy, renal function, chronic inflammatory disease or connective-tissue disease were excluded from this study.

 

Biochemical Analysis:

From all samples the fasting blood (fasting a minimum of 8 h) were taken. The blood samples were collected into plain tubes involve of the serum sample was operated to examine the biochemical parameters and therefore the ethylene diaminetetra acetic acid (EDTA) tubes was operated for molecular analysis. The blood samples were centrifuged at (4000 × g for five minute to isolated the plasma content. We determined the serum concentration of triglyceride (TG)32, total cholesterol (TC)33, low-density lipoprotein cholesterol (LDL), high-density lipoprotein cholesterol (HDL)34, creatinine (Cr), fasting glucose and blood urea nitrogen (BUN)35using apparatus for chemical analysis (Dimension AR/AVL (Clinical Chemistry System)36, Newark, NJ, USA) used by the Biotechnology Research/Molecular and Biotechnology laboratory/AL-Nahrain University.

 

DNA extraction:

Total blood samples were collected from vein of 70 Iraqi female patients with DM2 and 60 healthy samples as a controls. Total blood was collected into EDTA tube, then stored in -20°C until nearer used. DNA of these samples was extracted by using DNA extraction kit (Geneaid extraction kit, Korea).

 

Primers and Polymerase chain reaction:

The transcription factor 7-like 2 gene has been operated by design of one primer for amplification to scan the gene. A fragment 196 bp was amplified by use up forward primer F: 5′-GGCCTCTTTCATCACAGACC-3′ and reverse primer R: 5′- AGATGCAGCAAAGCCAAAGT -3′. The amplification reaction of PCR was held in a total volume of 20µl including of 5 µl of master mix (bioneer, USA) and 1 µl for each primer and 2 µl of DNA template than the mixture was finished to the total volume of 20µl with 11 µl of distal water. The programmed thermal cycler of PCR conditions were performed as follows: start denaturation at 95°C for 5min, obeyed by 35 cycles at 95°C for 30s, 58°C for 30sec then 72°C for 30s and completed with final extantion72°C for 5min.The PCR products were separated by agarose gel electrophoresis 1.5% and visualized through exposure to 302nm  ultraviolet light  after red safe  staining then sequencing of amplified products of TF7L2 gene were done by (Macrogen company/Korea).

 

 

Statistical Analysis:

All statistical analysis was done by using Statistical Package for the Social Sciences (SPSS 20). All variables were articulated as the mean ± standard deviation (SD). The differences between the DM2 patients and the control samples were evaluated using independent samples t test. Variables such as genotype and allele frequencies between DM2samples and controls were assessed using the x2test. Logistic regression analysis with odds ratio (OR) and 95% confidence interval (CI) were used to evaluate influence of major risk factors. pvalue < 0.05 was reflected statistically significant.

 

RESULTS:

Table 1appears clinical characteristics of DM2 patients and control sample in the female Iraqi patients. BMI, serum concentration of glucose, BUN, and TC were significantly greater for DM2 patients than for control samples (p < 0.05), whereas the serum concentration of uric acid (UA) HDL and LDL were significantly lesser for DM2 patients than for control samples (p < 0.05). While there was no significant difference in age, creatinine and the serum concentration of TG between DM2 patients and control samples (all p > 0.05).

 

Table 1:.Clinical characteristics of study samples.

Characteristics

DM2

Control

p value

Number (n)

70

60

 

Age (years)

31.24 ± 9.45

30.20 ± 9.45

0.065

BMI (kg/m2)

27.52 ± 4.87

26.95 ± 4.49

0.016 *

Glu (mmol/L)

9.52 ± 3.55

5.04 ± 0.99

<0.001*

TG (mmol/L)

2.01 ± 1.38

2.06 ± 1.69

0.946

TC (mmol/L)

4.72 ± 1.23

4.44 ± 1.71

<0.001 *

HDL (mmol/L)

1.04 ± 0.40

1.37 ± 0.33

<0.001*

LDL (mmol/L)

2.87 ± 0.84

3.00 ± 0.88

0.017 *

UA (mmol/L)

238.32 ± 72.35

240.59 ± 64.64

<0.001 *

Cr (umol/L)

57.71 ± 39.48

62.53 ± 20.38

0.124

BUN (mmol/L)

4.83 ± 2.16

4.76 ± 1.55

0.007 *

Variables are expressed as mean ± SD.DM2: type 2 diabetes mellitus; BMI: body mass index;;Glu:glucose; TG: triglyceride; TC: total cholesterol; HDL: high density lipoprotein; LDL: low density lipoprotein; UA: uricacid; Cr: creatinine; BUN: blood urea nitrogen.

 

Genetic analysis:-

The results showed there are two fragments amplified of TCF7L2gene has been detected in patients and normal samples 196 bp that  represented in Figure 1.

 

 

Figure 1: Show agarose gel electrophoresis for amplified TCl2f7 with fragment 196bp of children diastases belonging to healthy. Bands were fractionated by electrophoresis on 1.5 % agarose gel (2h, 5v/cm,1x tris-acetoc buffer staining with red safe stain) and visualized under U.V. lane (1,2,3,4,5) represented  patients sample and lane (7,8,9,10,11) represented healthy sample.

 

 

Table 2 shows the description of mutations in region of TCl2f7 for with fragment 196 bp of female diastases belonging to healthy.

 

 

Table 2 : Description of Mutations in region of TCl2f7 by using primer for 196 pb.

Range of nucleotide

Nucleotide

Location

Type of substitution

No. of sample

Sample

15660 to 15812

G>A

15810

Transition

56

Patients

15650 to 15812

G>A

15657

Transition

3

15650 to 15812

A>G

15658

Transition

5

15650 to 15812

G>T

15661

Transversion

6

15662 to 15812

G>A

15810

Transition

6

Controls

15660 to 15809

---------------

54

 

Figure2-5 shows the alignment from gene bank and sequence of TCF7L2 gene in sample controls and patients with T2DM, the sequence done by. The (G>A) variation observed in three patients in location 15656 and (56) patients in location 15810 while just shown for six healthy in same location. The (A>G) variation appeared in five patients in location 15658 while ((G>T) variation appeared in sex patients with DM2 in location 15658, and there were no variation found in (54) healthy controls and figure6 shows the sequencing of amplified products of TF7L2 gene.

 

 

Figures2: Alignment of 54 controls sample of TCl2F7 with standard TCl2F7 from Gene Bank

 

 

Figures 3: Alignment of 6 controls sample of TCl2F7 with standard TCl2F7 from Gene Bank

 

 

Figures (4): Alignment of 56 patients sample of TCF7L2 gene with standard TCl2F7 from Gene Bank

 

Figures 5:

 

 

Figures 6: sequencingsample ofTCl2f7gene of G/A Homozygous genotype and G/T Homozygous genotype.

 

Table 4 illustrations the distribution of the alleles and genotypes for the variations of TCF7L2 gene in the female Iraqi populace.

 

Table 4: Alleleand genotype distributions in patients and control samples.

Variants

DM2 n (%)

Control n (%)

p value

G/A

59(84.3%)

16(26.6%)

0.028 *

A/G

5(7.1%)

0(0%)

G/T

6(8.6%)

0(0%)

Allele

G

70(50%)

16(37.5%)

0.013*

A

64(45.7%)

16(37.5%)

T

6(4.3%)

0(0%)

 

The distribution of genotypes (G/A vs. AG + GT) and allele frequency indicated significant difference between DM2 and control samples (p = 0.028, p = 0.013). G and T allele was significantly higher in sample with DM2 than in controls (50% vs. 37.5%) and (45.7% vs. 37.5%)

 

Table 5 shows logistic regression analysis relating genotypes with following factors: the serum concentration of TC, TG, LDL and HDL which were the general confounding factors for DM2. In the present study, after multivariate alteration, remain significantly associated withDM2 (OR = 1.301, 95% confidence interval (CI): 1.019–1.660, p = 0.035;

 

Table 5:Logestic regression analysis for DM2 patients and control samples

Risk Factors

OR

95% CI

P

G/A vs. AG + GT

1.301

1.019–1.660

0.035 *

TG

0.876

0.822–0.932

<0.001 *

TC

1.509

1.338–1.701

<0.001 *

HDL

0.029

0.018–0.045

<0.001 *

LDL

0.779

0.646–0.940

0.009 *

DISCUSSION:

We obtained that variations in the TCF7L2 gene were associated with DM2 in a Iraqi female populace. To the greatest of our knowledge, this was the first study to investigate the association of the TCF7L2 gene polymorphisms with DM2 in a female populace of Iraqi.

 

The previous studies have concentrated on the significant role of TCF7L2 in cancer and oncogenes is development37,38. To identify the role of TCF7L2 in DM2and to conclude how variants of this gene affect sensitivity to DM2 we are needed functional analyses. DM2 is illustrated by impaired insulin secretion in response to increased metabolic requirement. This can be accredited to defective betacell mass and/or function39. This defect in betacell compensation appears to outcome from the interaction between genetic predisposition and environmental factors40.Shuet al. informed that regulation of TCF7L2 might play a significant role in the regulation of both betacell function and survival and that affecting its expression could be a different strategy to conserve betacell survival inDM2. Furthermore, Florezet al. 7proposed that common variants in TCF7L2 were related with an increased risk of diabetes in individuals with impaired glucose tolerance and maintained the concept that the risk-conferring genotypes in TCF7L2 were related with impaired betacell function but not with insulin resistance. In most human tissues TCF7L2 is expressed, comprising beta-cell, mature pancreatic with the exclusion of the skeletal muscle20. Intriguingly, TCF7L2 expression in adipose tissue is reduced in obese samples with DM220. Up till now, the exact mechanism of action of TCF7L2 in glucose metabolism and the pathogenesis of DM2 has still to be determined, but it is possible that TCF7L2 has a role in regulating glucose-sensitive insulin secretion from beta cell. The TCF7L2 gene encodes a transcription factor of the canonical Wnt signaling pathway, which is one of the key growth regulatory and development mechanisms of the cell that is play an important role in betacell insulin secretion and proliferation41,42alsoin intestinal cells effects synthesis of glucagon-like peptide 1 (GLP-1)43.

 

The GLP-1, in concert with insulin, plays a significant role in blood glucose homeostasis, and it has been assumed that TCF7L2 gene variants may stimulus the sensitivity to DM2 by indirectly changing GLP-1 levels 43. TCF7L2 has been recognized in glucose homeostasis across the regulation of pro-glucagon gene expression, which in intestinal cells encodes GLP-1 40. Additionally, Lyssenko et al. 44demonstrated that the raised risk of DM2via variants in TCF7L2 gene includes enhanced expression of the gene in islets, impaired insulin secretion, and enteroinsular axis. Actually, the TCF7L2 gene is observed as one of the greatest significant genes in determining the genetic sensitivity for DM2 in people. Van et al. 20described that variants of the TCF7L2 gene might change the susceptibility to DM2 in a Dutch population and located that the minor allele of the rs12255372 was significantly more frequent in DM2 patients than control samples, and the frequencies of the homozygous genotype (TT) and heterozygous genotype (GT)were also increased in DM2 patients. Kimber et al. 22originate that TCF7L2 was an essential gene for determining susceptibility to DM2 in a great sample study and proposed that variants of TCF7L2 might be related with increased therapeutic failure and DM2 severity in UK. Gonzalez-Sanchez et al. 23reported that the risk allele frequencies of rs7903146, rs12255372 and rs7901695 were significantly greater in DM2patientscontrasted with that in control samples and proposed that genetic variant in the TCF7L2 gene were main genetic influence of the risk of DM2 in Spain. In the analysis of Hayashi et al. 25in Japanese populaces all examined polymorphisms rs7901695, rs12255372, rs11196205 and rs7903146 were significantly related with DM2, and rs12255372shown the greatest association, while the frequency of the minor allele in Japanese populace was significantly lower than that in European populaces. Ren et al. 27 located that there was no correlation between TCF7L2 polymorphism and DM2 risk in Chinese Han people. In the analysis of Ng, et al.28, found that the additional SNP rs11196218, which located in nearby LD block in the intron 4 of TCF7L2 was significantly related with raised risk of DM2 in Chinese Han populace. Chang et al. [29] fixed that a new correlation of the genetic variant SNP rs290487 in the TCF7L2 gene with DM2 in the Chinese Han population. But, they did not realized any  correlation of the before reported risk allele rs12255372 T and rs7903146 T with DM2, which may due to their little frequency in the Chinese Han people45. In our study, we realized that the polymorphisms of TCF7L2 were correlated with risk of DM2 in the Iraqi female people. There was a significant difference in the genotype distribution of TCF7L2 between DM2patients and control samples. The G allele frequency of TCF7L2 gene was increase in DM2 patients than in control samples. This result showed that G allele of TCF7L2 gene was a risk factor for DM2 in female patients. And, the (G/A vs. AG + GT) was significantly greater in samples with DM2 than in healthy controls. after multivariate alteration of confusing factors, such as serum concentration of TC, TG, LDL, and HDL for DM2the significant difference was increase. Also, the G allele frequency of TCF7L2 gene was greater in DM2 patients than in control samples. This outcome indicated that the risk of DM2 was raised with the existence of the GA and GT genotype of TCF7L2 gene in Iraqi female.

 

In our study, the frequency of Gallele and A allele of TCF7L2 gene was significantly higher in the Iraqi female population. There were some limitations in this study. Firstly, this study was limited by the relatively small sample size of Iraqi female this may have guided to weak statistical significance and baggyCIs when calculate ingodd ratios. A greater sample size study is needed to investigate the correlation between the polymorphisms of the TCF7L2 and DM2 in female of the Iraqi people. Secondly, extra studies must to be undertaken to simplify the fundamental molecular mechanism that relates the TCF7L2 polymorphisms with DM2.While the correct biological mechanism for the correlation between the TCF7L2 gene and DM2risk stays uncertain, these constant findings signify that TCF7L2gene characterizes an important locus for expecting inherited susceptibility to DM2.

 

CONCLUSIONS

This is the first analysis to inspect the differences between the TCF7L2 gene andDM2 in a female population of Iraq. The present analysis specified that a significant correlation of the TCF7L2 variant with risk of diabetes mellitus type two was noticed in a female population of Iraq. This result may widen the information of genetic variants and disease relationship studies.

 

ACKNOWLEDGMENTS

The authors would like to thank all people who provided their blood sample and approval for genetic analysis.

 

REFERENCES

1.       Shovit Ranjan, Praveen Kumar Sharma. Association of Brain-Derived Neurotrophic factor (BDNF) gene SNP G196A with Type 2 Diabetes and Obesity: A Meta- Analysis.: Research Journal of Pharmacy and Technology.2017, 10, 4297-4305.

2.       Dhefer, I.H., Abbas, S, AR., Ahmed, N, SH., 2017. Polymorphism of P450, superfamily 19, polypeptide1, gene and related to aromatase enzyme activity in acromegaly Iraqi patients. Asian Journal of Pharmaceutical Clinical Research. 10, 228–232.

3.       Nolan, C.J., Damm, P., Prentki, M., 2011. Type 2 diabetes across generations: from pathophysiology to prevention and management. Lancet 378, 169–181.

4.       Ashcroft, F.M., Rorsman, P. Diabetes mellitus and the beta cell: the last ten years.Cell.2012, 148, 1160–1171.

5.       A Choudhury, RJ Mandade1, SH Patil, A Khan1, PD Warke and  KSPatil. Effect of Ficus glomerata Fruit Extract on Various Biochemical Parameters in Alloxan Induced Diabetic Rats. Research Journal of Pharmacognosy and Phytochemistry.2010, 2, 82-84.

6.       Dr. Suresh Kumar Sutrakar, Dr. Drutpal Singh Baghel. Biochemical Parameters Variations in Type–II Diabetes Mellitus: Special Reference in Rewa Region. Asian Journal of Research in Chemistry .2014, 7, 877-881.

7.       Florez, J.C., Jablonski, K.A., Bayley, N., Pollin, T.I., De Bakker, P.I., Shuldiner, A.R., Knowler, W.C., Nathan, D.M., Altshuler, D., Diabetes Prevention Program Research, G, 2006.TCF7L2 polymorphisms and progression to diabetes in the Diabetes Prevention Program. N. Engl. J. Med. 355, 241–250.

8.       Wang, J., Kuusisto, J., Vanttinen, M., Kuulasmaa, T., Lindstrom, J., Tuomilehto, J., Uusitupa, M., Laakso, M., 2007. Variants of transcription factor 7-like 2 (TCF7L2) gene predict conversion to type 2 diabetes in the Finnish diabetes prevention study and are associated with impaired glucose regulation and impaired insulin secretion. Diabetologia 50, 1192–1200.

9.       Alibegovic, A. C., Sonne, M. P., Hojbjerre, L., Hansen, T., Pedersen, O., Van Hall, G., Holst, J. J., Stallknecht, B., Dela, F. & Vaag, A. 2010. The T-allele of TCF7L2 rs7903146 associates with a reduced compensation of insulin secretion for insulin resistance induced by 9 days of bed rest. Diabetes, 59, 836–43.

10.     Giannini, C., Dalla Man, C., Groop, L., Cobelli, C., Zhao, H., Shaw, M.M., Duran, E., Pierpont, B., Bale, A.E., Caprio, S., Santoro, N., 2014. Co-occurrence of risk alleles in or near genes modulating insulin secretion predisposes obese youth to prediabetes. Diabetes Care 37, 475–482.

11.     Heni, M., Ketterer, C., Thamer, C., Herzberg-Schafer, S.A., Guthoff, M., Stefan, N., Machicao, F., Staiger, H., Fritsche, A., HARING, H.U., 2010. Glycemia determines the effect of type 2 diabetes risk genes on insulin secretion. Diabetes 59, 3247–3252.

12.     Faerch, K., Pilgaard, K., Knop, F.K., Hansen, T., Pedersen, O., Jorgensen, T., Holst, J.J., 2013.Incretin and pancreatic hormone secretion in Caucasian non-diabetic carriers of the TCF7L2 rs7903146 risk T allele. Diabetes Obes. Metab. 15, 91–95.

13.     Schafer, S.A., Tschritter, O., Machicao, F., Thamer, C., Stefan, N., Gallwitz, B., Holst, J.J., Dekker, J.M., T Hart, L.M., Nijpels, G., Van Haeften, T.W., Haring, H.U., Fritsche, A.,2007. Impaired glucagon-like peptide-1-induced insulin secretion in carriers of transcription factor 7-like 2 (TCF7L2) gene polymorphisms. Diabetologia 50, 2443–2450.

14.     Shu, L., Matveyenko, A.V., Kerr-Conte, J., Cho, J.H., Mcintosh, C.H., Maedler, K., 2009. Decreased TCF7L2 protein levels in type 2 diabetes mellitus correlate with down regulation of GIP- and GLP-1 receptors and impaired beta-cell function. Hum. Mol. Genet. 18, 2388–2399.

15.     Boj, S.F., Van Es, J.H., Huch, M., Li, V.S., Jose, A., Hatzis, P., Mokry, M., Haegebarth, A., Van Den Born, M., Chambon, P., Voshol, P., Dor, Y., Cuppen, E., Fillat, C., Clevers, H., 2012. Diabetes risk gene and Wnt effector Tcf7l2/TCF4 controls hepatic response to perinatal and adult metabolic demand. Cell 151, 1595–1607.

16.     Cropano, C., Santoro, N., Groop, L., Dalla Man, C., Cobelli, C., Galderisi, A., Kursawe, R., Pierpont, B., Goffredo, M., Caprio, S., 2017. The rs7903146 variant in the TCF7L2 gene increases the risk of prediabetes/type 2 diabetes in obese adolescents by impairing beta-cell function and hepatic insulin sensitivity. Diabetes Care 40,1082–1089.

17.     Zhou, Y., Park, S.Y., Su, J., Bailey, K., Ottosson-Laakso, E., Shcherbina, L., Oskolkov, N., Zhang, E., Thevenin, T., Fadista, J., Bennet, H., Vikman, P., Wierup, N., Fex, M., Rung,J., Wollheim, C., Nobrega, M., Renstrom, E., Groop, L., Hansson, O., 2014. TCF7L2 is amaster regulator of insulin production and processing. Hum. Mol. Genet. 23, 6419–6431.

18.     Le Bacquer, O., Kerr-Conte, J., Gargani, S., Delalleau, N., Huyvaert, M., GMYR, V., Froguel, P., Neve, B., Pattou, F., 2012. TCF7L2 rs7903146 impairs islet function and morphology in non-diabetic individuals. Diabetologia 55, 2677–2681.

19.     Mitchell, R.K., Mondragon, A., Chen, L., Mcginty, J.A., French, P.M., Ferrer, J., Thorens, B., Hodson, D.J., Rutter, G.A., Da Silva Xavier, G., 2015. Selective disruption of Tcf7l2 in the pancreatic beta cell impairs secretory function and lowers beta cell mass. Hum. Mol. Genet. 24, 1390–1399.

20.     Van, J.V.; Shiri-Sverdlov, R.; Zhernakova, A.; Strengman, E.; Van, T.W.; Hofker, M.H.; Wijmenga, C. Association of variants of transcription factor 7-like 2 (TCF7L2) with susceptibility to type 2 diabetes in the Dutch Breda cohort. Diabetologia 2007, 50, 59–62.

21.     Kimber, C.H.; Doney, A.; Pearson, E.R.; McCarthy, M.I.; Hattersley, A.T.; Leese, G.P.; Morris, A.D.; Palmer, C. TCF7L2 in the Go-DARTS study: Evidence for a gene dose effect on both diabetes susceptibility and control of glucose levels. Diabetologia 2007, 50, 1186–1191.

22.     Gonzalez-Sanchez, J.L.; Martinez-Larrad, M.T.; Zabena, C.; Perez-Barba, M.; Serrano-Rios, M. Association of variants of the TCF7L2 gene with increases in the risk of type 2 diabetes and the proinsulin: insulin ratio in the Spanish population. Diabetologia 2008, 51, 1993–1997.

23.     Sale, M.M.; Smith, S.G.; Mychaleckyj, J.C.; Keene, K.L.; Langefeld, C.D.; Leak, T.S.; Hicks, P.J.; Bowden, D.W.; Rich, S.S.; Freedman, B.I. Variants of the transcription factor 7-like 2 (TCF7L2) gene are associated with type 2 diabetes in an African-American population enriched for nephropathy. Diabetes 2007, 56, 2638–2642.

24.     Hayashi, T.; Iwamoto, Y.; Kaku, K.; Hirose, H.; Maeda, S. Replication study for the association of TCF7L2 with susceptibility to type 2 diabetes in a Japanese population. Diabetologia. 2007, 50, 980–984.

25.     Chandak, G.R.; Janipalli, C.S.; Bhaskar, S.; Kulkarni, S.R.; Mohankrishna, P.; Hattersley, A.T.; Frayling, T.M.; Yajnik, C.S. Common variants in the TCF7L2 gene are strongly associated with type 2 diabetes mellitus in the Indian population. Diabetologia 2007, 50, 63–67.

26.     Ren, Q.; Han, X.Y.; Wang, F.; Zhang, X.Y.; Han, L.C.; Luo, Y.Y.; Zhou, X.H.; Ji, L.N.Exon sequencing and association analysis of polymorphisms in TCF7L2 with type 2 diabetes in aChinese population. Diabetologia 2008, 51, 1146–1152.

27.     Ng, M.C.; Tam, C.H.; Lam, V.K.; So, W.; Ma, R.C.; Chan, J.C. Replication and identification of novel variants at TCF7L2 associated with type 2 diabetes in Hong Kong Chinese. J. Clin. Endocr. Metab. 2007, 92, 3733–3737.

28.     Chang, Y.; Chang, T.; Jiang, Y.; Kuo, S.; Lee, K.; Chiu, K.C.; Chuang, L. Association study of the genetic polymorphisms of the transcription factor 7-like 2 (TCF7L2) gene and type 2 diabetes in the Chinese population. Diabetes 2007, 56, 2631–2637.

29.     Gao, Y.; Xie, X.; Ma, Y.; Yang, Y.; Li, X.; Fu, Z.; Zheng, Y.; Ma, X.; Chen, B.; Liu, F. Genetic variation in Tanis was associated with elevating plasma triglyceride level in Chinese nondiabetic subjects. Lipids Health Dis. 2013, 12, 97–84.

30.     Fu, Z.; Yang, H.; Ma, Y.; Huang, D.; Xie, X.; Zheng, Y.; Zhu, Q.; Nakayama, T. Haplotype study of  the CYP4A11 gene and coronary artery disease in Han and Uygur populations in China. Gene 2013,512, 510–516.

31.     Mawhoob N. Alkadasi, Abdulsalam Mohammed Alshami, H.Y. Alhabal. Study the Relation of Serum Lipids with Body Mass Index Among Students in  Zabeed Education Collage, Hudaiadah University, Yemen. Asian Journal of Pharmaceutical Analysis.2015,5,31-35.

32.     Ashok Kumar; Meera; SunitaLega; Satyender K. Yadav. Spectral techniques for identification of triglycerides. Asian Journal of Research in Chemistry 2017, 10, 708–710.

33.     Kalaivanan S, Sarumathy S, AnishaEbens J, Naresh Kumar K, Roobena Parveen A, Nasreen Ashraf M. Clinical Assessment and Comparison of Lipid Profiles among Coronary Artery Disease and type 2 Diabetes Mellitus Patients receiving Statin Therapy. Research Journal of Pharmacy and Technology.2017,10,18-20.

34.     Senan Ibrahim; Mohammad Imad Khayat; Mohamad Ayman Awama. Comparative Study for the measurement of HDL Cholesterol between a direct Assay and a Precipitation Method. Research Journal of Pharmacy and Technology.2018, 11, 1035-1038.

35.     SubashVijaya Kumar, M Sasi Kala, Satyendra Garg, Guru Sharan, Manoj K Deka. A Prospective Study of Aetiology, Pathogenesis, Management and Outcome of Acute Renal Failure..Research Journal of Pharmacy and Technology.2010, 3, 327-332.

36.     Alok Kumar Verma; Dr. G.P. Dubey; Dr. Aruna Agrawal. Biochemical Studies on Serum Hb, Sugar, Urea and Lipid Profile under Influence of Ocimum sanctum L in Aged Patients. Research Journal of Pharmacy and Technology. 2012, 5, 791–794.

37.     Van, D.; Wetering, M.; Sancho, E.; Verweij, C. The β-catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Cell 2002, 111, 241–250.

38.     Jiang, Y.; Zhou, X.; Liu, Y.; Wu, X.; Huang, X. Association of hTcf-4 gene expression and mutation with clinicopathological characteristics of hepatocellular carcinoma. World J. Gastroentero. 2002,8, 804–807.

39.     Tianxin Sheng, Yunhe Lu, Kangjuan Yang, Yan Jin, Yinghua Wu, Zibo Zhang, YanhuaJin, XiongjiJin. Association between Single Nucleotide Polymorphisms (SNPs) in the Promoter of Adiponectin Gene, Hypoadiponectinemia, and Diabetes. Research Journal of Science and Technology. 2016, 8, 34–40.

40.     Fatemeh Haidari, Esmat Mansoori, Mehrnoosh Zakerkish, Mohammad hossein Haghighizadeh. The Relationship between Metabolic Factors and Quality of Life Aspects in Type 2 Diabetes Patients. Research Journal of Pharmacy and Technology. 2017, 10, 1491-1496.

41.     Rulifson, I.C.; Karnik, S.K.; Heiser, P.W.; Ten, B.D.; Chen, H. Gu, X.; Taketo, M.M.; Nusse, R.; Hebrok, M.; Kim, S.K. Wnt signaling regulates pancreatic β cell proliferation. Proc. Natl. Acad. Sci.U.S.A. 2007, 104, 6247–6252.

42.     Smith, U. TCF7L2 and type 2 diabetes—We WNT to know. Diabetologia2007, 50, 5–7.

43.     Yi, F.; Brubake, P.L.; Jin, T. TCF-4 mediates cell type-specific regulation of proglucagon gene expression by β-catenin and glycogen synthase kinase-3β. J. Biol. Chem. 2005, 280, 1457–1464.

44.     Lyssenko, V.; Lupi, R.; Marchetti, P.; Del, G.S.; Orho-Melander, M.; Almgren, P.; Sjögren, M.; Ling, C.; Eriksson, K.; Mancarella, R. Mechanisms by which common variants in the TCF7L2 geneincrease risk of type 2 diabetes. J. Clin. Invest. 2007, 117, 2155–2163.

45.     Dai, C.; Xie, X.; Yang, Y.; Li, X.; Zheng, Y.; Fu, Z.; Liu, F.; Chen, B.; Gai, M.; Ma, Y. Relationship between CYP17A1 genetic polymorphism and coronary artery disease in a Chinese Han population. Lipids Health Dis. 2015, 14, 16.

 

 

Received on 21.01.2018       Modified on 18.05.2018

Accepted on 20.07.2018      ©A&V Publications All right reserved

Research J. Science and Tech. 2019; 11(1):01-08.

DOI: 10.5958/2349-2988.2019.00001.9